Web Analytics Made Easy - StatCounter
Comunicaciones
Safe Creative #1912290338994

Estudios en el viroma del olivo en España, el olivavirus OLYaV (Autora: A.B. Ruiz-García)

En un reciente trabajo el uso de secuenciación masiva (HTS) para el análisis de olivos españoles que mostraban decoloración de hojas y amarilleamiento, la defoliación y/o el declive ha proporcionado nuevos conocimientos sobre los virus de olivo presentes en España y ha abierto debates sobre las ventajas e inconvenientes de estas tecnologías con fines diagnósticos (Ruiz-García AB, Canales C, Morán F, Ruiz-Torres M, Herrera-Mármol M, Olmos A. Characterization of Spanish Olive Virome by High Throughput Sequencing Opens New Insights and Uncertainties. Viruses. 2021 Nov 6;13:2233). En este estudio describimos por primera vez en el olivar español la presencia del virus asociado al amarillamiento de la hoja del olivo (OLYaV), un virus cuya secuencia completa fue obtenida por nuestro grupo previamente y que ofrece información para la creación de un nuevo género (Olivavirus) en la familia Closteroviridae (véase la comunicación del 17/10/2020).

En la figura 1 se muestra la sintomatología observada en campo en árboles de olivo.


Captura de pantalla 2022-04-03 a las 13.34.39

Figura 1. Síntomas de defoliación, muerte y amarilleamiento de hojas causados por OLYaV.

La comparación entre las secuencias nucleotídica/proteínica del nuevo aislado español de OLYaV y las secuencias nucleotídica/proteínica del aislado brasileño previamente secuenciado por nuestro equipo también, se muestra en la figura 2.

Captura de pantalla 2022-04-03 a las 13.39.00

Como se puede observar las regiones más óptimas para la detección del virus deberán basarse en la región 5’UTR, p21 y/o 3’UTR y no la HSP70 que es la que actualmente se emplea y tiene un bajo porcentaje de homología (79.8%) lo que implica la presencia de falsos negativos porque la técnica puede no cubrir la variabilidad del virus.


Además se ha obtenido la segunda secuencia completa de OLYaV. Este virus también se ha detectado en un posible vector, el psílido Euphyllura olivina. Además, se ha confirmado en España también la presencia de Olea europaea geminivirus (OEGV), recientemente informado en Italia, y se ha obtenido la secuencia completa de dos aislados por secuenciación HTS y por secuenciación Sanger.


Comments

El níspero como nuevo huesped del viroide del manzano de cabeza de martillo (Autora: A.B. Ruiz-García)

En prospecciones de níspero en zonas productoras se detectó por primera vez como huésped alternativo un viroide que había sido descrito infectando manzano. El viroide del manzano de cabeza de martillo (AHVd). El viroide se identificó en una muestra de níspero la SL73.6 que se analizó por secuenciacón masiva. Entre los contigs relacionados con virus/viroides ensamblados a partir de datos SL73.6 HTS, se encontraron dos contigs de 489 y 376 nt relacionados con el viroide AHVd. El análisis bioinformático de estos contigs permitió la recuperación de un genoma circular completo de 376 nt cubierto por 7014 lecturas (cobertura promedio 2515.5x), el aislado AHVd-SL73.6 (depositado en GenBank, número de acceso OK272503). Para confirmar la presencia de AHVd en esta muestra, el genoma completo se secuenció mediante Sanger tras la amplificada por RT-PCR utilizando cebadores adyacentes de opuesta polaridad. Se obtuvo un producto de 376 pb, que se clonó y al secuenciarlo mediante Sanger, se confirmó la secuencia obtenida por HTS al 100%. Estos resultados muestran por primera vez la presencia de AHVd infectando al níspero, identificando así a este cultivo como un nuevo huésped de esta especie de viroide. El aislado de níspero español AHVd mostró una alta identidad de nucleótidos (93,97%) con el aislado de referencia (NC_028132, KR605506) de China, aunque el genoma AHVd-SL73.6 fue más corto (376 nt frente a 434 nt) debido a una eliminación de 56 nt en la posición genómica 55-110 y una deleción de 2 nt en la posición genómica 419-420 con respecto a la secuencia de referencia. Sin embargo, la estructura secundaria predicha para AHVd-SL73.6 mostró un plegamiento similar a los descritos previamente, resultando en una conformación característica de Pelamoviroides compuestos por un dominio en forma de barilla que contiene los nucleótidos que forman la estructura de cabeza de martillo y un dominio multiramificado.

En la siguiente figura se observa la estructura secundaria del viroide aislado de níspero.
Captura de pantalla 2022-04-03 a las 13.00.59
Comments

Primeras detecciones de la falsa sharka en níspero en España (Autora: A.B. Ruiz-García)

Continuando con el níspero y avanzar en el conocimiento de su estado sanitario en España, en prospecciones realizadas en áreas productoras de níspero se ha detectado por primera la presencia del virus de la falsa sharka, apple clorotic leaf spot virus (ACLSV) en níspero con una alta incidencia del 31.76%.
La secuencia y caracterización genómica del primer aislado español de ACLSV infectando níspero se realizó de la siguiente forma.
El análisis por secuenciación masiva (HTS) realizado en el ARN total extraído de la muestra SL73.6 rindió 31.867.726 lecturas d con un tamaño promedio de 134,8 nt. Se realizó la sustracción del genoma del níspero, tras el control de calidad de las lecturas y eliminar los adaptadores, lo que resultó en 1.698.300 lecturas que se utilizaron para el ensamblado de novo que dio lugar a 13.797 contigs. Se anotaron los contigs relacionados con virus
y viroides mediante BLASTN/X. Este análisis mostró 11 contigs de tamaños entre
6511 y 281 nt relacionados con ACLSV, confirmando la presencia de ACLSV en la muestra. La extensión de los contigs realizando el mapeo de las lecturas contra los contigs permitió la recuperación de un genoma casi completo de 7533 nt, cubierto por 44 039 lecturas (cobertura promedio 857,2x), aislado llamado SL73.6 y depositado en GenBank, número de acceso OK272502. Este aislado mostró el mayor porcentaje de identidad a nivel nueclotídico (83,7%) con el aislado alemán 38/85-B (KX579123) de manzano. El mapa de la organización del genoma SL73.6, la cobertura promedio de HTS y la similitud de proteínas de sus ORF con el aislado de ACLSV más cercano (KX579123) se muestran en la Figura1
Captura de pantalla 2022-04-03 a las 11.46.43

Figura 1. Similaridad aminoacídica del aislado SL73.6 con los ORFs del aislado de ACLSV más próximo (KX579123). Se muestra la cobertura por HTS.

En la siguiente figura se muestra la relación filogenética del aislado de ACLSV de níspero con otros aislados de ACLSV de otros orígenes y de otros hospedados.

Captura de pantalla 2022-04-03 a las 12.11.04
Comments

Primeras detecciones de apple stem grooving virus en níspero en España (Autora: A.B. Ruiz-García)

En prospecciones realizadas en áreas productoras de níspero se ha detectado por primera vez en España la presencia en este huésped leñoso del virus apple stem grooving virus con una incidencia de 6.59%.
La secuencia y caracterización genómica del primer aislado español de ASGV infectando níspero se realizó de la siguiente forma.
Se analizó por secuenciación masiva la muestra SL73.32 que dio como resultado 52.353.872 lecturas (con un promedio de tamaño de 134,34 nt). Se realizó el control de calidad con el recorte de adaptadores y de secuencias que no tenían la calidad suficiente. Las lecturas se mapearon contra el genoma de níspero para la sustracción del genoma del huésped y las 566.878 lecturas no relacionadas se sometieron a ensamblaje de novo, generando 519 contigs. Entre ellos, 7 contigs estaban relacionados, mediante análisis BLASTN/X, con el virus ASGV y tenían unos tamaños que oscilaron entre 1523 nt y 310 nt . El remapeo de las lecturas contra los contigs permitió la superposición entre algunos de los contigs y la recuperación de 3 secuencias parciales de 730, 1260 y 4291 nt que cubren el 96,7 % del genoma, faltando 98 nt en el extremo 5 prima; dos pequeñas regiones de codificación de 33 nt y 37 nt en el ORF1; y 48 nt en el extremo 3 prima, respecto a la secuencia de referencia (NC_001749). Para cubrir las dos brechas de ORF1, se realizaron RT-PCR y secuenciación de Sanger. La superposición entre las secuencias HTS parciales y las secuencias amplificadas por RT-PCR resultó en el ensamblaje de una secuencia de codificación ASGV de longitud casi completa de 6345 nt, SL73.32 (depositado en GenBank, número de acceso OK272504). SL73.32 mostró el mayor porcentaje de identidad de nucleótidos (95,1 %) con el aislado de cítricos FKSS2 (LC143387) de Japón y una similitud de nucleótidos del 83,42% con el aislado de níspero L3 de China (MK599422). Estos resultados confirman la aparición de ASGV en nísperos en España. El mapa de la organización genómica de SL73.32, cobertura promedio de HTS y similitud de proteínas de sus ORF con el aislado de ASGV más cercano (LC143387) se muestra en la Figura 1.

Captura de pantalla 2022-04-03 a las 11.11.34

El estudio filogenético del aislado viral de níspero español con otros aislados en otros cultivos y con los aislados ASGV de cítricos (también denominados CTLV) se muestra en la Figura 2

Captura de pantalla 2022-04-03 a las 11.22.10
Comments

Primera detección en España de PeSV en granado (Autora: A.B. Ruiz-García)

En nuestro laboratorio se analizaron muestras de hojas de granados que crecían en Alicante (España) y que mostraban manchas cloróticas a lo largo de las nervaduras. Para identificar con seguridad el agente causal se procedió a realizar un análisis mediante secuenciación masiva RNAseq (HTS, tecnología TrueSeq Illumina). Los datos se analizaron utilizando CLC Genomics Workbench 10.1.1. Se realizó el control de calidad y la sustracción del genoma del huésped. El ensamblado de novo de las 1887133 lecturas generó 10.946 contigs (> 200 nt), de los cuales 128 estaban relacionados con PeSV según el análisis BLAST (e-value < 10e–4). Estos contigs mostraron una alta variabilidad molecular lo que indicó una infección mixta por varios aislados de PeSV.
La extensión de los contig se realizó mediante el programa Geneious Prime y permitió recuperar una secuencia genómica de PeSV de 9926 nt casi completa (MZ361583, cobertura promedio 528x). Esta secuencia mostró una identidad de nucleótidos del 78,1 al 80,8 % en comparación con las secuencias genómicas de PeSV (MT680930-MT680935). No se detectó ningún otro virus en el análisis HTS.
La RT-PCR de la planta de granado original con los cebadores diseñados en este trabajo SPeSV-6F (5'-GGCTAGAAACGGTGGGATGA-3') y SPeSV-6R (5'-ACCACCTGGCTCATGGCGA-3') produjo un amplicón esperado de 165 nt, cuya secuencia fue confirmada por secuenciación de Sanger (100% de identidad de nt con la secuencia HTS).
Análisis posteriores sobre 64 árboles mostraron que 17 de ellos estaban infectados por PeSV. PeSV no se detectó en plantas asintomáticas. La mayor parte de árboles sintomáticos dieron positivo para PeSV aunque en alguno de ellos no se detectó por el método desarrollado lo que pone en evidencia la necesidad de mejorar los métodos de detección de este virus emergente en un cultivo de importancia en España como es el granado.

Captura de pantalla 2022-04-03 a las 10.32.36 1

Para la primera descripción del granado como hospedado de PeSV y visualización con más detalle de la sintomatología producida por este virus se puede consultar la comunicación del 25 de noviembre de 2020.
Comments

Primeras detecciones de plum bark necrosis stem pitting associated virus en cerezo dulce en España (Autora: A.B. Ruiz-García)

En prospecciones en un area de cultivo de cerezo se analizaron muestras para estudiar el estado sanitario del cerezo. En el marco de esta prospección, se analizó una muestra (P7) de un cerezo dulce (Prunus avium), del cultivar Planera, que mostraba enrojecimiento y manchas necróticas en las hojas y se analizó mediante secuenciación masiva (HTS) con la plataforma NextSeq 500. El análisis de datos se realizó utilizando el software CLC Genomics Workbench 10.1.1 y Geneious 9.1.8. Después del control de calidad realizado por el software CLC, la muestra P7 rindió 42.683.262 lecturas. El ensamblado de novo produjo un total de 6.270 contigs (tamaño promedio de 1.884 nt). Los contigs posteriormente se analizaron por BLASTN y BLASTX. Este análisis mostró que ocho contigs estaban relacionados con el virus plum bark necrosis stem pitting associated virus (PBNSPaV). Tabién se detectó la presencia del virus cherry virus A representado con la presencia de 11 contigs.
Se realizó un análisis adicional mediante el mapeo de las lecturas contra todas las secuencias completas de PBNSPaV disponibles en las bases de datos utilizando el software Geneious. Los mejores resultados de mapeo se obtuvieron usando el aislado Pair-2 (KC590345) de Francia como referencia, lo que permitió la recuperación de una secuencia de 14.199 nt, que representa el genoma casi completo del aislado P7 (número de acceso de GenBank MN228561).
La identidad de nucleótidos entre el aislado P7 y el Par-2 fue del 99,27 %. Para confirmar la presencia de PBNSPaV en la muestra P7, se realizó la amplificación de una región parcial del gen CP por RT-PCR utilizando los cebadores específicos PBN-CP-F y PBN-CP-R. El producto de PCR de 301 pb obtenido (MN240523) fue secuenciado por Sanger y confirmó con 100% de identidad de la secuencia P7 recuperada por HTS (excluyendo los cebadores usados ​​para la amplificación).
Un total de 24 muestras recogidas de la misma zona de cultivo de cerezo se analizaron mediante RT-PCR utilizando los mismos cebadores. Siete de estas muestras dieron positivo para PBNSPaV, lo que confirma aún más la presencia del virus en cerezp dulce en España. Este es el primer informe de PBNSPaV infectando cerezo dulce en España, lo que contribuye a una mejor comprensión de la epidemiología y la distribución del rango de huéspedes de este patógeno.
Comments

Actualización sobre las especies de virus que infectan vid (Autora: A.B. Ruiz-García)

Hasta la fecha, se han detectado 86 virus que infectan vides de todo el mundo. Algunos de estos virus se asocian con enfermedades económicamente perjudiciales y están asociados con los cuatro principales complejos de enfermedades conocidos como degeneración infecciosa, enrollado, madera rugosa y jaspeado.

A continuación una actualización de los virus que infectan vid:
virusvidAvirusvidB
Comments

Recordando que el virus de los cítricos Citrus tatter feaf ha sido detectado por primera vez en Europa (Autora: A.B. Ruiz-García)

El virus de la hoja de cítricos Citrus tatter leaf virus (CTLV) es un capillovirus que pertenece a la familia Betaflexiviridae que se transmite de forma mecánica aunque no se han identificado todavía vectores.

Actualmente la ICTV lo considera como una cepa de un virus conocido de frutales, el Apple stem grooving virus (ASGV).

La mayoría de las variedades de cítricos comerciales infectadas son asintomáticas excepto cuando se propagan sobre patrones Poncirus trifoliata o Poncirus trifoliata x Citrus sinensis. Es entonces cuando los árboles presentan enanismo, hojas cloróticas, incompatibilidad en la unión del injerto lo que conlleva a al deterioro final del árbol. Esto supone un problema grave porque los patrones basados en Poncirus trifoliata y sus híbridos se utilizan ampliamente en todas las zonas productoras del mundo por su tolerancia al virus de la tristeza de los cítricos y a las especies de Phytophthora.

Este virus se describió por primera vez en California y posteriormente en Australia, Korea, Nigeria, Japan, Sudafrica, y China.

Sin embargo en el año 2019 (Turgut Alas et al., Saudi Journal of Biological Sciences 26, 995-998) detectaron este virus Chipre, siendo la primera detección del este virus en cítricos en Europa.

La sintomatología que los autores observaron fue la siguiente:

Pasted Graphic

Distorsión de hojas, necrosis y síntomas cloróticos en hojas infectadas con CTLV (T. Alas et al. 2019)

Para la identificación del virus emplearon RT-PCR convencional empleando los iniciadores específicos:

TL1F: TGAAAACCTTTGCTGCCACCTCT
TL1R: TACTCTCCGAACCTGCCTCGAAA

que amplificaba un fragmento de 309 pb a una temperatura de annealing de 59ºC

Se trata pues de una detección muy a tener en cuenta puesto que este virus se ha considerado hasta la fecha como de cuarentena para la citricultura española.
Comments

¿Qué son los aislados Resistance-Breaking (RB) del virus de la tristeza de los cítricos? (Autora: A.B. Ruiz-García)



Tener controlada mediante patrones tolerantes la enfermedad de la tristeza de los cítricos causada por el virus CTV y que ha producido la muerte de más de 50 millones de árboles sólo en España, no quiere decir que debamos olvidar esta problemática.

Los virus evolucionan, se adaptan, mutan y recombinan para vencer resistencias de hospedadores y avanzar en su objetivo, su supervivencia. Y así han aparecido y se han descrito nuevos grupos o genotipos de CTV, como el caso de los aislados Resistance Breaking (RB) formados por un grupo de aislados con características genéticas y biológicas particulares, que se han dividido en dos genotipos, los del grupo 1 RB y los del grupo 2 RB.

Los aislados RB, a diferencia del resto de aislados del virus de la tristeza, pueden replicarse y moverse de forma sistémica en Poncirus trifoliata, que muestra resistencia a otros aislados de CTV.
Estos genotipos RB, se han descrito en Nueva Zelanda, República Dominicana, Puerto Rico, Sudáfrica, California, Brasil y Marruecos.

En España solo existen aislados poco agresivos de CTV, que producen tristeza cuando naranjos dulces, mandarinos, limas y pomelos se injertan sobre naranjo amargo, y se produce una incompatibilidad entre patrón y variedad, por lo que se mantiene como prioridad evitar la entrada de CTV no europeos que incluyen ahora los aislados RB para preservar nuestra citricultura.

Se han diseñado y validado los iniciadores específicos siguientes que permiten realizar PCRs convencionales. El protocolo de detección es el siguiente:

Muestreo: 5 brotes terminales (10 cm) alrededor de la copa del árbol

Purificación de ácidos nucleicos: RNeasy Plant kit o similar

Preparación del cóctel:
Para cada reacción de 25 microlitros (3 microlitros de RNA purificado)

H2O 10,7 microlitros
Tampón 5x Promega 5 microlitros
Cl2Mg 25 mM (uso 1,5 mM) 1,5 microlitros
dNTP (2,5 mM cada uno) uso 0,25 mM 2,5 microlitros
Iniciador F1 (25 microM) uso 1microM 1 microlitro
Inciador R1 (25 microM) uso 1microM 1 microlitro
Promega AMV (10U/microlitro) 0,1 microlitros
GoTaq G2 Promega (5 U/microlitro) 0,2 microlitros

Según el genotipo se seleccionan los iniciadores:

RB group1
Iniciador F1 AGT GGT GGA GAT TAC GTT G
Inciador R1 TAC ACG CGA CAA ATC GAG

RB group 2
Iniciador F1 CGG AAG GGA CTA CGT GGT
Iniciador R1 CGT TTG CAC GGG TTC AAT G



Condiciones del Termociclador
40 min -----------------42ºC
4 min ------------------- 94ºC

40 ciclos:
30 s ---------------------- 92ºC
30 s ---------------------- 60ºC
1 min -------------------- 72ºC

10 min ----------------- 72ºC

Comments

El granado nuevo hesped del virus passiflora edulis symptomless virus (Autora: A.B. Ruiz-García)

En uno de nuestros trabajos recientes (Caglayan, K.; Gazel, M.; Roumi, V.; Kocabag, H.D.; Tunç, B.; Reynard, J.S.; Ruiz-García, A.B.; Olmos, A. & Candresse, T. 2020. Identification of Pomegranate as a New Host of Passiflora Edulis Symptomless Virus (PeSV) and Analysis of PeSV Diversity. Agronomy 2020, 10, 1821) hemos identificado el virus pastaflora edulis symptomless virus (PeSV) en plantas de granado son sintomatología similar a la que produce el virus de la sharka. PeSV ha sido propuesto recientemente como un nuevo miembro de la familia Potiviridae, dentro del género Roymovirus. El genoma de las dos especies descritas de este género, rose yellow mosaic virus y PeSV muestran peculiaridades respecto a otros potyvirus, en particular, un sitio adicional de escisión de NIa-Pro en la proteína 6K2-NIa-VPg, la ausencia de motivos de transmisión de áfidos tanto en HC-Pro como en CP, así como la presencia de un supuesto motivo de transmisión de ácaros en la CP.

Captura de pantalla 2022-04-03 a las 9.32.15

Figura 1: Síntomas producidos por la infección causada por PeSV en granado. Anillos cloróticos, clorosis nervial y anillos cloróticos a lo largo de las nervaduras centrales.

La estructura genómica de diversos aislados del virus se han obtenido y es común la confección de diferentes variantes virales en el mismo árbol.


Captura de pantalla 2022-04-03 a las 9.57.07


Figura 2. Genoma del aislado (PeSV)-PS1-5.

Además en este estudio, se realizó microscopio electrónica y se observaron partículas similares a las de los potyvirus. Se emplearon plantas de granado sintomáticas para extraer los viriones. Los viriones que se observaron eran filamentos flexibles y con una longitud de entre 760 a 780 nm y de 11 a 20 nm de ancho, con simetría helicoidal.


Captura de pantalla 2022-04-03 a las 10.08.47

Figura 3. Microscopía electrónica empleando un microscopio de transmisión. La escala corresponde a 100nm en la fotografía de la izquierda y a 200 nm en la de la derecha.

Comments

Apple stem pitting virus, un virus de amplia distribución y que infecta diversas especies vegetales (Autora: A.B. Ruiz-García)

Apple stem pitting virus es un virus que está presente a nivel mundial y se ha descrito infectando manzano, peral, espino, membrillo y cerezo. A pesar de haber sido relacionado con problemas como epinastia, o punteaduras en madera en manzano, amarilleamiento de nervaduras o manchas necrosantes en pera y deformaciones en frutos de membrillo, de forma mucho más frecuente se ha relacionado a infecciones asintomáticas. Diversos estudios han visto la enorme variabilidad genética de este virus, y esta variabilidad se ha propuesta como la causa de su facilidad de adaptación a nuevos huéspedes.
En un estudio realizado en nuestro laboratorio en una prospección de níspero en la región de Segorbe, hemos detectado unas variantes capaces de infectar el níspero aunque sin producir sintomatología.

Para avanzar en el conocimiento y poder disponer de herramientas de diagnóstico de estas variantes de níspero, se ha secuenciado completamente un aislado y caracterizamos parcialmente 10 aislados más para ver filogenéticamente donde se situaban.

La estructura del aislado de níspero muestra que mantiene los cinco ORFs (RdRP, TGB1, TGB2, TGB3 y CP) como se muestra en la figura

aspv

El análisis filogenético del aislado completo de ASPV lo sitúa próximo a las variantes de peral en color verde.

glbo

El níspero se confirma como nuevo huésped de ASPV y se han diseñado iniciadores adaptados a la secuencia del aislado del níspero que ha permitido evaluar la prevalencia en Segorbe que ha resultado ser del 15%.


Comments

Un misterio resuelto, el virus asociado al amarilleamiento de la hoja del olivo aporta datos clave para la creación de un nuevo género en la familia Closteroviridae, para el que se propone el nombre Olivavirus (Autora: A.B. Ruiz-García)

En la reciente publicación que tenemos (Ruiz-García, A.B.; Candresse, T.; Canales, C.; Morán, F.; Machado de Oliveira, C.; Bertolini, E.; Olmos, A. Molecular Characterization of the Complete Coding Sequence of Olive Leaf Yellowing-Associated Virus. Plants 2020, 9, 1272. https://doi.org/10.3390/plants9101272) se ha avanzado en el conocimiento del virus asociado al amarilleamiento de la hoja del olivo (OLYaV) y aporta información clave para la creación de un nuevo género en la familia Closteroviridae para el que se propone el nombre de Olivavirus.
El virus asociado al amarilleamiento de la hoja del olivo (OYLaV) se describió por primera vez en 1999, en Italia, en olivos de la variedad Biancolilla. Estos olivos mostraban decoloraciones del verde en las hojas, y tenían una coloración amarillo brillante. Sin embargo sólo se logró una caracterización parcial de un gen (HSP70) pero esta pequeña secuencia permitió que pudiera ser asignado a la familia
Closteroviridae.
Estudios posteriores sólo avanzaron parcialmente en su conocimiento del genoma, ya que únicamente se logró conocer alrededor de 5000 nucleótidos. Con este conocimiento se diseñaron técnicas de diagnóstico y se averiguó que OLYaV era uno de los virus del olivo más extendidos en muchas zonas donde se cultivaba. Así, se descubrieron diferentes niveles de incidencia: California (EE. UU.) (93%), Italia (64-21%), Túnez (49%), Líbano (24%), Siria (15%), Grecia (5%) y Albania (2%).
Sin embargo OLYaV permanecía como una especie no asignada en la familia Closteroviridae porque se necesitaban más datos biológicos y moleculares para su clasificación.
En un estudio que recientemente hemos publicado, hemos descubierto la secuencia completa de OYLaV de 16700 nucleótidos, incluyendo todo su potencial de codificación.

En la figura se muestra la organización genómica de OLYaV. L-Pro: proteasa leader papain-like; Met-T: dominio metal transferasa; Helicase: dominio de la helicasa viral; RdRp: polimerasa RNA dependiente; Las flechas azules indican la posición de corte del proteasa.


clost

La secuencia completa muestra un genoma con estructura típica de la familia Closteroviridae. Contiene 11 pautas de lectura abiertas (ORF,) entre ellos el complejo ORF1ab que codifica para los tres dominios conservados típicos, proteasa líder similar a la papaína, metiltransferasa y helicasa y además la RdRp, además de los genes de las proteínas HSP70 y HSP90.

OLYaV exhibe dos características genómicas originales. Primero, la ORF2 codifica una proteína similar a la taumatina y segundo, no codifica una proteína CPm. Curiosamente, estas dos características genómicas son compartidas por otras dos especies de Closteroviridae no asignadas, PVB and AV1. Además el análisis filogenético, fundamentalmente el estudio de los genes comunes en todas las especies de closterovirus (ORF1a, ORF1b (RdRp), HSP70, HSP90 y CP) ha abierto nuevas posibilidades en la clasificación taxonómica de OLYaV y del persimmon virus B (PVB) y el actidinia virus 1 (AV1), lo que sugiere de forma consistente que forman un nuevo género dentro de la familia Closteroviridae.

Comments

Primera detección del Grapevine asteroid mosaic associated virus en viñas de Tempranillo y Macabeo en España (Autora: A.B. Ruiz-García)

El virus asociado al mosaico asteroide de la vid (GAMaV) pertenece al género Marafivirus de la familia Tymoviridae. GAMaV se encontró por primera vez infectando una vid en California y posteriormente se descubrió en Japón, Canadá, Uruguay, Francia, Hungría e Italia. En julio de 2019 una muestra de vid de la variedad Tempranillo (TS1), recogida durante uno de nuestros muestreos aleatorios en al D.O. Utiel-Requena, y que mostraba moteado clorótico y deformación en hojas, se analizó por secuenciación masiva (HTS). El análisis de esta muestra mostró que estaba infectada por diversos virus y viroides (grapevine rupestris stem pitting-associated virus, grapevine leafroll-associated virus 3, grapevine virus A, grapevine fleck virus, grapevine red globe virus, grapevine rupestris vein feathering virus y hop stunt viroid).
Además de estos se descubrió la presencia del virus asteroide de la vid y la secuencia completa se recuperó siendo de 6692 nucletótidos. El análisis filogenético mostró que el aislado español se situaba en un clado diferente a los que previamente estaban descritos, como se muestra en la figura.

clados


Basándonos en la secuencia del aislado TS1 diseñamos dos iniciadores - GAMaV-6010F, 5’CCCTCCTCCTAGCGACGACC3’ y GAMaV- 6426R, 5’GGGTTGAGACGGCGGAGATC3’ - que amplifican un fragmento de 417 nt en la región de la cáspida y que ha permitido detectar los aislados españoles con fiabilidad, revelando una incidencia en el area estudiada de casi el 10%, puesto que los análisis con los iniciadores descritos por otros autores no detectaban los españoles. Estas han sido las primeras detecciones en España de este virus.

Comments

Clasificación de virus vegetales de doble cadena de RNA (Autora: A.B. Ruiz-García)

Hay algunos virus de RNA de doble cadena que infectan plantas que se clasifican fundamentalmente en:


Familia Amalgaviridae

  • Género
    • Amalgavirus


Familia Partitiviridae

  • Géneros

  • Alphapartitivirus
  • Betapartitivirus
  • Deltapartitivirus


Familia Reoviridae

Subfamilia Spinareovirinae

  • Géneros

  • Fijivirus
  • Oryzavirus

Subfamilia Sedoreovirinae

  • Género

  • Phytoreovirus
Comments

Muestreo para el virus de la sharka (Autora: A.B. Ruiz-García)

El muestreo debe tener en cuenta la biología del virus y las condiciones climáticas locales, en particular las condiciones del tiempo durante la temporada de crecimiento

Se han de tomar si es posible muestras con síntomas típicos: flores, hojas y frutos que presenten los síntomas

En caso de ser muestras sin síntomas: brotes de por lo menos un año con hojas maduras o completamente desarrolladas de la parte central de cada una de las ramas principales (la detección no es fiable en brotes de menos de un año). Las muestras deberían tomarse, como mínimo, en cuatro sitios diferentes (p. ej., cuatro ramas o cuatro hojas) de cada planta; esto es indispensable ya que la distribución del PPV es desigual

El muestreo no debería realizarse durante los meses de temperaturas más altas

Las pruebas son menos fiables si se realizan con muestras tomadas durante el otoño que con las obtenidas al principio de la primavera

En primavera, las muestras pueden ser flores, brotes con las hojas totalmente desarrolladas o frutos.

En verano y en otoño pueden utilizarse para el análisis las hojas maduras y la piel de los frutos maduros recogidos del campo o de los lugares de embalaje.

Las flores, las hojas, los brotes y la piel del fruto pueden almacenarse a una temperatura de 4ºC por no más de 10 días antes del procesamiento.

Los frutos pueden almacenarse durante un mes a una temperatura de 4ºC antes del procesamiento.

En invierno pueden seleccionarse las yemas dormidas o los tejidos de corteza de la zona basal de ramillas, brotes y ramas, o espolones enteros.

Comments

La psorosis de los cítricos severa transmisible B (Autora: A.B. Ruiz-García)

La psoriasis o psorosis severa transmisible es una de las enfermedades de cítricos que no están presentes en España y causa la muerte de árboles en muchas regiones de Argentina, siendo una amenaza a los países productores. De hecho en Argentina la psoriasis severa muestra que tras 15 años después de plantar el 35% de las plantas originalmente sanas tiene síntomas foliares y el 16% lesiones en la corteza y concretamente en pomelo el 49% tienen síntomas y el 21% lesiones en corteza.

La psoriasis severa transmisible o Psoriasis B se encuentra en Argentina y en Uruguay y está ausente en la región EPPO.

La transmisión se ha asociado por un lado al hongo Olpidoium brassiacae

hongo

Síntomas

Presencia de descamaciones en la corteza del tronco y ramas
Los síntomas se inician cuando el árbol tiene de 10-15 años con pequeñas lesiones en la corteza
Las lesiones se levantan, se secan y se van desprendiendo
La psorosis B causa descamamiento exuberante en ramas delgadas de los árboles incluso en ramas de menos de 1cm de diámetro




psos

Otras características son que algunas lesiones exudan goma en los límites de las zonas descamadas y en corte transversal de ramas afectadas en la madera se observan zonas de color pardo y de forma irregular que son exudaciones de goma que invaden los vasos de xilema.


gom
Comments

Primeras infecciones mixtas en cerezo por diferentes genotipos del virus de la cereza pequeña (Autora: A.B. Ruiz-García)

El virus de la cereza pequeña (Little cherry virus 1 - LChV-1) es un miembro del género Velarivirus de la familia Closteroviridae y tiene importancia en el cultivo del cerezo, ya que se ha asociado a diferentes desórdenes en la planta como enanismo o el síndrome Shirofugen. En el año 2016, nuestro equipo de investigación realizó las primeras detecciones en España de este virus, empleando la tecnología de la secuenciación masiva (high throughput sequencing -HTS), que permitió mediante el análisis de pequeños RNAs interferentes la recuperación completa de la secuencia genómica de dos aislados del virus (KX192366 - aislado Jerte y KX192367 - aislado Ponferrada). Más recientemente en un nuevo estudio, hemos podido recuperar las secuencias completas de dos aislados diferentes (MH300060 - aislado P8-23 y MH300061 - aislado P8-42), que estaban coinfectando un cerezo dulce (cv. Planera) de Alicante, España, con síntomas de enrojecimiento en las hojas.


hojaslchv1lchv12

Este tipo de infecciones mixtas en cerezo con diferentes genotipos de LChV-1 no habían sido descritas hasta la fecha. Ya que no existe vector conocido del virus, la coexistencia de estas variantes podría ser atribuida a prácticas agronómicas como el injerto. Estas infecciones mixtas pueden tener implicaciones en la patogenicidad del virus ya que pueden además producirse recombinaciones. La presencia de dos genotipos diferentes además sugiere dos eventos diferentes de introducción en España.

En un estudio que hemos realizado en colaboración con investigadores de Francia, Grecia y Eslovaquia, hemos logrado un avance en el conocimiento de la diversidad del virus ampliando las cuatro agrupaciones o “clusters” que se conocían a cinco. Estos avances permiten el diseño de nuevas herramientas de diagnóstico capaces de detectar todas las variantes de LChV-1 conocidas hasta el momento.

En la figura de abajo se muestra un árbol filogenético (Maximum likelihood; 500 réplicas) que relaciona las secuencias completas disponibles hasta la fecha del LChV-1.


lchv3
Comments

De vuelta con el Grapevine pinot gris virus, y los que no disponen de PCR a tiempo real? (Autora: A.B. Ruiz-García)

Y para los que no disponen de un equipo de PCR a tiempo real? ¿cómo se puede detectar?
Pues con una RT-PCR convencional y para ello os indicamos unos iniciadores que amplifican diferentes regiones del genoma del virus.
Nuestra recomendación, al menos utilizar dos PCRs diferentes, porque este virus es variable y así disminuimos posibilidades de falsos negativos.

Iniciadores de Beuve et al.:

Proteína de movimiento (770pb)
Pg-Mer-F1 5′-GGAGTTGCCTTCGTTTACGA-3′
Pg-Mer-R1 5′-GTACTTGATTCGCCTC GCTCA-3′


Iniciadores de Glasa et al.:

5’UTR (618pb)
GPG-14F 5’-AATTGATCCCGTGTAGTGC-3’
GPG-632R 5’-TCCGAGGACGATGAACCTC-3’

Proteína de movimiento (302pb)
GPG-5637F 5’-ATTGCGGAGTTGCCTTCAAG-3’
GPG-5939R 5’-CTGAGAAGCATTGTCCCATC-3’

Proteína de cápside (411pb)
GPG-6609F 5’-GAGATCAACAGTCAGGAGAG-3’
GPG-7020R 5’-GACTTCTGGTGCCTTATCAC-3’


El protocolo para su detección por RT-PCR convencional es el siguiente:

Muestreo: 4 brotes terminales (10 cm) alrededor de la cepa

Purificación de ácidos nucleicos: RNeasy Plant kit o similar

Preparación del cóctel: Para cada reacción de 25 microlitros (3 microlitros de RNA purificado)

H2O 10,7 microlitros
Tampón 5x Promega 5 microlitros
Cl2Mg 25 mM (uso 1,5 mM) 1,5 microlitros
dNTP (2,5 mM cada uno) uso 0,25 mM 2,5 microlitros
Iniciador 1 (25 microM) uso 1microM 1 microlitro
Iniciador 2 (25 microM) uso 1microM 1 microlitros
GoTaq G2 Promega (5 U/microlitro) 0,2 microlitros
AMV Promega (10 U/microlitro) 0,1 microlitro


Condiciones del Termociclador

30 min ------------------ 45ºC
4 min ------------------- 94ºC
40 ciclos: 30 s ---------------------- 92ºC
30 s ---------------------- 50ºC
1 min -------------------- 72ºC
10 min ----------------- 72ºC
Comments

Un virus emergente en vid, Grapevine pinot gris virus (Autora: A.B. Ruiz-García)

Hacia el año 2004 una nueva enfermedad en vid apareció en Italia en Trentino, que producía retraso y reducción del crecimiento general de la planta, pérdida de vigor de las cepas, enanismo en sarmientos y que presentaba malformaciones en hojas y moteados cloróticos. La aplicación de la tecnología de la secuenciación masiva permitió a un grupo de investigación italiano en el año 2012 la identificación de un nuevo virus del género Trichovirus, de la familia Betaflexiviridae, asociado a cepas que presentaban síntomas de la enfermedad. El genoma del virus consiste en una molécula de ARN de polaridad positiva de entre 7223 y 7275 nucleótidos excluyendo la cola poli A en el extremo 3’ del virus. El genoma contiene tres marcos de lectura abiertos (ORF) solapantes y dos regiones no traducidas, una en el extremo 5’ y otra en el extremo 3’. El primer ORF codifica una metiltransferasa, una helicasa y la ARN polimerasa dependiente de ARN, el segundo ORF codifica la proteína de movimiento, y el tercer ORF la proteína de la cáspida.
Desde su primera descripción en Italia, el virus se ha descrito en otros países como Grecia, República Checa, Eslovaquia, Eslovenia, Francia, Alemania, Portugal, Corea del Sur, China, Canadá, EEUU, Turquía, Brasil, Croacia, Rumanía, Ucrania o Australia.
En España nuestro grupo de investigación describió por primera su presencia en el país en el año 2017, infectando variedades de Garnacha, Bobal y Tempranillo. Con el objetivo de comprender y mejorar la epidemiología de la enfermedad y desarrollar estrategias de control hemos desarrollado una RT-PCR a tiempo real que permite la detección y cuantificación del virus, con un limite de 70 copias del virus en material vegetal. También se ha aplicado a la detección en un posible vector Colomerus vitis.


gpgv1gpgv2

Además hemos descubierto un nuevo polimorfismo en el genoma del virus que hace que la proteína de movimiento sea más pequeña.


gpgv6

Un estudio filogenético basado en esta región genómica muestra una alta variaibilidad entre los aislados españoles, que se localizan en diversos grupos o “clusters” independientemente de tener o no polimorfismos en la proteína de movimiento (nuevo polimorfismo, círculo rojo completo; polimorfismo previamente descrito por un grupo italiano, círculo con sólo la circunferencia roja)



El desarrollo de esta metodología de detección y el avance en la diversidad del virus, permitirá mejorar herramientas de control y diagnóstico del virus.

Comments

La importancia de los insectos vectores en la dipersión de los virus (Autora: A.B. Ruiz-García)

Los hemípteros son el grupo de insectos vectores más importantes en la transmisión de virus vegetales que se transmiten por insectos ya que representan más del 70% de insectos transmisores de virus. Entre ellos los pulgones y las moscas blancas transmiten más de 500 especies de virus vegetales. Enfermedades de gran impacto económico, como la enfermedad de la tristeza de los cítricos o la enfermedad de la sharka de los frutales, se transmiten por pulgón, por lo que la dispersión a corta distancia la realiza la fauna afídica de forma natural lo que puede llegar a producir grandes epidemias a nivel local. Los virus suponen un problema creciente, cada vez de mayor importancia, especialmente en las condiciones mediterráneas, que favorecen el desarrollo de sus vectores. Dependiendo del tiempo en el que el vector es virulífero y capaz de transmitir la infección, los virus se clasifican según su tipo de transmisión como persistentes, semipersistentes o no persistentes y según su ruta dentro del vector como circulativos o no circulativos. Los virus no persistentes tienen un periodo corto de retención en el estilete del áfido, el virus se transmite en las siguientes picaduras de prueba que realiza el pulgón una vez éste lo ha adquirido. Los virus semipersistentes son aquellos que se retienen por un periodo algo mayor en el estilete del vector o en su inestino anterior, aunque tampoco necesitan un periodo de latencia entre la adquisición y la transmisión. Los virus persistentes son aquellos que necesitan periodos más largos para la adquisición del virus y su transmisión, que pueden llegar a ser varios días y tienen un periodo de latencia en donde el vector tiene el virus pero no es todavía capaz de transmitirlo. Por otra parte los virus no circultativos son aquello que para su transmisión únicamente se requiere que se adhiera a cutículas de estilete o intestino anterior, mientras que los circulativos entran en sistema circulatorio del insecto y se acumulan en las glándulas salivares.


Comments