Web Analytics Made Easy - StatCounter
Archives for June 2018 | Comunicaciones Safe Creative #1912290338994 Safe Creative #2301210360532

Otros virus de cítricos de gran importancia (Autora: A.B. Ruiz-García)

Hay una serie de virus de cítricos de enorme importancia por sus implicación económicas y agronómicas

Entre los virus de los cítricos no presentes en la UE destacan:

El virus que se asocia a la enfermedad de la clorosis nervial de los cítricos. Esta enfermedad está causada por un virus recientemente identificado del género Mandarivirus la especie Citrus yellow vein clearing virus.
Este virus se ha encontrado en China, Pakistán, Turquía, India e Irán.
Fundamentalmente afecta a limonero produciendo una gran necrosis y clorosis nervial, además de distorsión de hojas en limonero con reducción significativa de producción y calidad de fruta. Además se transmite por vectores A. spireacola y Dialeurodes citri.

Otro virus importante es el virus del mosaico amarillo de los cítricos presente en India. Es un virus transmitido por Planococcus citri. Produce síntomas en mosaico en hojas infectadas. Produce síntomas en naranjo amargo, reduciendo el tamaño de las hojas y hace que los árboles infectados sean raquíticos. El agente causal es Citrus yellow mosaic virus. Es un Badnavirus que puede integrarse en el genoma de la planta y por tanto su control es muy difícil y es de cuarentena en muchos países incluyendo EEUU o Nueva Zelanda.

La psoriasis severa transmisible, es una enfermedad de importancia en los países que la tienen. Esta enfermedad está producida por Citrus psorosis virus B, un Ophiovirus. La psoriasis tipo B es muy agresiva y tiene un desarrollo rápido, incluso en ramas secundarias. Está persente en Argentina e Uruguay. Se ha sugerido su transmisión por áfidos y se ha asociado a transmisión por el hongo Olpidoium brassiacae.

La muerte súbita de los cítricos de es una enfermedad muy grave que se ha descrito en Brasil, que afecta a árboles injertados sobre lima Rangpur, Citrus volkameriana, Citrus jambiri y Citrus pennivisiculata. El decaimiento del naranjo puede ser tan rápido que el árbol que no se produce la abscisión de los frutos, quedando todavía en el árbol muerto y seco. Se observa una coloración amarilla en el tronco del patrón. La enfermedad se transmite por T. citricida y A. spiraecola. Se ha asociado a la presencia de varios virus entre los que se ha identificado un tymovirus, un genotipo de la especie Citrus sudden death-associated virus.

Otro virus de importancia es el Citrus chlorotic associated dwarf virus. Presente en Turquía. Transmitido por mosca blanca. Afecta a todas las variedades de limonero, a la mayor parte de mandarinos e híbridos, produciendo abolladuras y variaciones en hojas maduras y tamaño reducido de la planta con deformaciones y fuerte clorosis.

Citrus tatter leaf virus es un capillovirus y aunque en la mayoría de cítricos es asintomático el injerto de Poncirus trifoliata con hibridos infectados produce aparición de síntomas graves como enanismo, amarilleamiento, defoliación, mariñaque por encima de la linea de injerto y falta de unión.


Hay dos viroides de cítricos de importancia:

El viroide de la caquexia o xiloporosis Citrus cachexia viroid produce amarilleamiento progresivo de la copa del árbol por pérdida de follaje, detención del crecimiento y finalmente la muerte del árbol. La unión del injerto presenta miriñaque con acanaladuras en tronco impregnadas de goma. De hecho la caquexia es una variante agresiva de Hop stunt viroid.

El viroide de la exocortis Citrus exocortis viroid produce grietas verticales y escamas en la corteza, manchas amarillas y enanismo y decaimiento.
Comments

Primera detección de Grapevnie Syrah virus 1 en España (Autora: A.B. Ruiz-García)

El virus Grapevine Syrah-1 (GSyV-1) es un miembro del género Marafivirus de la familia Tymoviridae. Aunque se ha descrito GSyV-1 infectando vid (Vitis vinifera L.) en bastantes países (Estados Unidos, Chile, Italia, Francia, Eslovaquia, la República Checa, Brasil, Hungría, Sudáfrica y Turquía), no se ha asociado todavía claramente con una enfermedad. En unas prospecciones realizadas de forma rutinaria en diferentes areas productoras de Cataluña (D.O. Montsant, D.O. Priorat y D.O. Terra Alta) se detectó en una muestra de la variedad Garnacha que presentaba enrojecimiento de hojas y otros síntomas virales, la presencia de este virus por primera vez en España. Sin embargo el viroma de la misma planta también contenía otros virus y viroides (Grapevine fanleaf virus, Grapevine fleck virus, Grapevine leafroll-associated virus 1, Grapevine leafroll-associated virus 2, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine rupestris stem pitting-associated virus, Hop stunt viroid, and Grapevine yellow speckle viroid 1), por lo que de nuevo la sintomatología no se pudo asociar a este virus. La confirmación de la presencia en España se realizó mediante RT-PCR convencional y los iniciadores específicos de GSyV-1, la pareja SY5922F 5′- CCAATGGGTCGCACTTGTTG -3′ y SY6295R 5′- ACTTCATGGTGGTGCCGGTG -3′ (Glasa et al.), detectándose en diferentes muestras de Garnacha.

gel
Comments