Web Analytics Made Easy - StatCounter
Recordando que el virus de los cítricos Citrus tatter feaf ha sido detectado por primera vez en Europa (Autora: A.B. Ruiz-García) | Comunicaciones
Safe Creative #1912290338994

Recordando que el virus de los cítricos Citrus tatter feaf ha sido detectado por primera vez en Europa (Autora: A.B. Ruiz-García)

El virus de la hoja de cítricos Citrus tatter leaf virus (CTLV) es un capillovirus que pertenece a la familia Betaflexiviridae que se transmite de forma mecánica aunque no se han identificado todavía vectores.

Actualmente la ICTV lo considera como una cepa de un virus conocido de frutales, el Apple stem grooving virus (ASGV).

La mayoría de las variedades de cítricos comerciales infectadas son asintomáticas excepto cuando se propagan sobre patrones Poncirus trifoliata o Poncirus trifoliata x Citrus sinensis. Es entonces cuando los árboles presentan enanismo, hojas cloróticas, incompatibilidad en la unión del injerto lo que conlleva a al deterioro final del árbol. Esto supone un problema grave porque los patrones basados en Poncirus trifoliata y sus híbridos se utilizan ampliamente en todas las zonas productoras del mundo por su tolerancia al virus de la tristeza de los cítricos y a las especies de Phytophthora.

Este virus se describió por primera vez en California y posteriormente en Australia, Korea, Nigeria, Japan, Sudafrica, y China.

Sin embargo en el año 2019 (Turgut Alas et al., Saudi Journal of Biological Sciences 26, 995-998) detectaron este virus Chipre, siendo la primera detección del este virus en cítricos en Europa.

La sintomatología que los autores observaron fue la siguiente:

Pasted Graphic

Distorsión de hojas, necrosis y síntomas cloróticos en hojas infectadas con CTLV (T. Alas et al. 2019)

Para la identificación del virus emplearon RT-PCR convencional empleando los iniciadores específicos:

TL1F: TGAAAACCTTTGCTGCCACCTCT
TL1R: TACTCTCCGAACCTGCCTCGAAA

que amplificaba un fragmento de 309 pb a una temperatura de annealing de 59ºC

Se trata pues de una detección muy a tener en cuenta puesto que este virus se ha considerado hasta la fecha como de cuarentena para la citricultura española.
blog comments powered by Disqus